Please see below Class 12 Biology Sample Paper Set C with solutions. We have provided Class 12 Biology Sample Papers with solutions designed by Biology teachers for Class 12 based on the latest examination pattern issued by CBSE. We have provided the following sample paper for Class 12 Biology with answers. You will be able to understand the type of questions which can come in the upcoming exams.

CBSE Sample Paper for Class 12 Biology Set C

SECTION – A

1. Give reasons why micropyle remains as a small pore in the seed coat of a seed.
Answer : Micropyle remains as a small pore in the seed coat to facilitate entry of O2 and water into the seed during germination.

2. Why pollen tablets are in use by people these days?
Answer : Pollen tablets are used as food supplement by people to improve health.

3. Name the embryonic stage that gets implanted in the uterine wall of human female.
Answer : Blastocyst

4. Write the physiological reason, why a woman generally cannot conceive a child after 50 years of age.
Answer : A woman generally cannot conceive a child after 50 years of age as at this age menopause occurs. It is a phase in a woman’s life when ovulation and menstruation stops.

5. A geneticist interested in studying variations and patterns of inheritance in living beings prefers to choose organisms for experiments with shorter life cycle. Provide a reason.
Answer : Living beings with shorter life cycles are preferred by geneticists for studying variations and patterns of inheritance because such organisms complete their life cycle in short duration and produce large number of progenies in less time span, e.g., pea plant used in Mendel’s experiments.

6. Mention the type of allele that expresses itself only in homozygous state in an organism.
Answer : Recessive allele, e.g., tt represents dwarf plant.

7. How is repetitive/satellite DNA separated from bulk genomic DNA for various genetic experiments?
Answer : Repetitive/satellite DNA can be separated from bulk genomic DNA by using density gradient centrifugation.

8. How is Agrobacterium tumefaciens able to transform a normal plant cell into a tumor?
Answer : When Agrobacterium tumefaciens infects a plant cell, its Ti plasmid (Ti-tumour inducing plasmid) transfers a piece of its DNA known as ‘T-DNA’ into plant cells and transform normal plant cells into a tumour.

9. Write the importance of the bacterium Thermus aquaticus in polymerase chain reaction.
Answer : Taq DNA polymerase is isolated from thermophilic bacterium Thermus aquaticus. It is used to synthesise the segment of DNA between the primers (extension) in polymerase chain reaction at high temperatures.

10. “India has greater ecosystem diversity than Norway”. Do you agree with the statement? Give reasons in support of your answer.
Answer : Yes, India has greater ecosystem diversity than Norway as India comes under the tropical region whereas, Norway lies in temperate region. Tropical regions account for greater biological diversity as they have deserts, rainforests, mangroves, coral reefs, wetlands, estuaries and alpine meadows than temperate regions. In tropical region more solar energy is available that also promotes higher productivity and increased biological diversity.

11. Assertion : Monogenes produce continuous variations in the expression of traits.
Reason : Monogenic inheritance controls quantitative trait.
(a) Both assertion and reason are true, and reason is the correct explanation of assertion.
(b) Both assertion and reason are true, but reason is not the correct explanation of assertion.
(c) Assertion is true but reason is false.
(d) Both assertion and reason are false.
Answer : D

OR

Assertion : Down’s syndrome is a genetic disorder caused due to the presence of an additional copy of X-chromosome.
Reason : Both X chromosomes pass into single egg due to non disjunction during oogenesis.
(a) Both assertion and reason are true, and reason is the correct explanation of assertion.
(b) Both assertion and reason are true, but reason is not the correct explanation of assertion.
(c) Assertion is true but reason is false.
(d) Both assertion and reason are false.
Answer : D

12. Assertion : PCR primers must not have self complementary regions.
Reason : Self complementary regions result in hairpin structures adversely affecting the PCR.
(a) Both assertion and reason are true, and reason is the correct explanation of assertion.
(b) Both assertion and reason are true, but reason is not the correct explanation of assertion.
(c) Assertion is true but reason is false.
(d) Both assertion and reason are false.
Answer : A

13. Assertion : Offsite collections can be used to restock depleted populations, reintroduce species in the wild and restore degraded habitats.
Reason : In situ conservation refers to the conservation of endangered species in their natural habitats.
(a) Both assertion and reason are true, and reason is the correct explanation of assertion.
(b) Both assertion and reason are true, but reason is not the correct explanation of assertion.
(c) Assertion is true but reason is false.
(d) Both assertion and reason are false.
Answer : B

14. Assertion : Plant-animal interactions do not generally involve co-evolution of the mutualist organisms.
Reason : Evolution of the plants and animals can never go side by side.
(a) Both assertion and reason are true, and reason is the correct explanation of assertion.
(b) Both assertion and reason are true, but reason is not the correct explanation of assertion.
(c) Assertion is true but reason is false.
(d) Both assertion and reason are false.
Answer : D

15. Read the following and answer any four questions from 15(i) to 15(v) given below:
Some microbes and the products derived from them are very useful in our daily life. The production of curd from milk is one of the most common examples of microbes benefits to humans. Microorganisms such as Lactobacillus and others commonly called lactic acid bacteria (LAB) are responsible for the formation of curd. Microbes are also used in preparation of many foods such as the rice dough for dosa and idli, bread,che ese and some traditional drinks like toddy, etc.

(i) Which of the following microbes is generally used in bread making?
(a) Baker’s yeast
(b) Propionibacterium shermanii
(c) Lactobacillus
(d) Lactic acid bacteria
Answer : A

(ii) The preparation of which of the following things does not require microbes?
(a) Pizza
(b) Toddy
(c) Swiss cheese
(d) Rice
Answer : D

(iii) The large holes in Swiss cheese is a resultant of ___________.
(a) anerobic respiration in microbes
(b) aerobic respiration in microbes
(c) fermentation
(d) both (a) and (c)
Answer : D

(iv) How lactic acid bacteria increase the quality of milk?
(a) Turning it into cheese
(b) Increasing vitamin B12
(c) Turning it into curd
(d) None of these
Answer : B

(v) Assertion : Lactic acid bacteria are very beneficial to humans.
Reason : Lactic acid bacteria checks the growth of disease causing microbes in stomach.
(a) Both assertion and reason are true, and the reason is the correct explanation of the assertion.
(b) Both assertion and reason are true, but the reason is not the correct explanation of the assertion.
(c) Assertion is true but reason is false.
(d) Both assertion and reason are false.
Answer : A

16. Read the following and answer any four questions from 16(i) to 16(v) given below:
India is one of the 12 megadiversity countries of the world as it holds only 2.4 per cent area of the world’s land area but it shares 8.1 per cent to the global species diversity. Nearly 45,000 species of plants and twice as many of animals have been recorded from India. The distribution of the huge variety of plants and animals is not uniform throughout the world. Species diversity generally decreases on moving towards the poles from the equator. With very few exceptions, tropics (latitudinal range of 23.5° N to 23.5° S) harbour more species than temperate or polar areas. The largely tropical Amazonian rainforest in South America has the greatest biodiversity on earth. The reason behind this latitudinal variation include speciation, relatively constant tropical environment as compared to temperate environment, and the high availability of solar energy in the tropics.

(i) Unlike temperate environment, tropical environments have more species diversity as it has __________.
(a) less seasonal variations
(b) high solar energy
(c) less precipitation
(d) both (a) and (b)
Answer : D

(ii) Polar areas have __________ species diversity as compared to tropics.
(a) less
(b) more
(c) almost equal
(d) can not say
Answer : A

(iii) Amazon rainforests are also known as ______________________.
(a) Heart of Earth
(b) Brain of Earth
(c) Lungs of Earth
(d) Liver of Earth
Answer : C

(iv) The reason behind the the latitudinal variation in vegetation might be due to
(a) seasonal differences
(b) sunlight variations
(c) precipitation differences
(d) all of these.
Answer : D

(v) Read the following statements.
I. Amazon rain forest has maximum diversity due to the seasonal variations.
II. Western ghat have almost stable with less seasonal variations.
III. Thar desert have least biodiversity.
Choose from below the correct alternative.
(a) Only I is true.
(b) Only II and III are true
(c) Only I and III is true
(d) I, II and III are true.
Answer : B

SECTION – B

17. A childless couple has agreed for a test tube baby programme. List only the basic steps the procedure would involve to conceive the baby.
Answer : Two principle procedures adopted for test tube baby programme are ZIFT (Zygote Intra Fallopian Transfer) and IUT (Intra Uterine Transfer). In this procedure fusion of ovum and sperm is done outside the body of a woman, in the laboratory to form a zygote. The zygote is then allowed to divide forming 8 blastomeres and is transferred into the Fallopian tube (ZIFT – Zygote Intra Fallopian Transfer). If the embryo is with more than 8 blastomeres it is transferred into the uterus (IUT – Intra Uterine Transfer) to complete its further development. Thus , this is in vitro fertilisation (IVF – fertilisation outside the body in almost similar conditions as that in the body) followed by embryo transfer (ET). 

OR

List the different parts of the human oviduct through which the ovum travels till it meets the sperm for fertilisation.
Answer :  Fimbriae, infundibulum, ampulla and isthmus are the main parts of oviduct, through which ovum travels till it meets the sperm for fertilisation. Finally it reaches the ampullary-isthmic junction of oviduct.

18. (Image 154)
Given above is a schematic representation of the lac operon in E.coli. What is the significant role of ‘i’ gene in switching on or off the operon? 
Answer : ‘i’ gene is regulator gene. It produces a repressor, which binds to the operator gene and stops its working. This ‘i’ gene exerts a negative control over the working of structural genes.

19. Identify A, B, C and D in the following table: (Image 154)
Answer :  A – Heroine B – Cardiovascular system C – Cocaine D- Central nervous system 

OR

List the two types of immunity a human baby is born with. Explain the differences between the two types.
Answer : Two types of immunity with which human baby is born include-
(i) Innate immunity – It is inherited by an organism from the parents and protects it from birth throughout the life. It is not specific to particular pathogen and consists of four types of barriers – physical, physiological, cellular and cytokine.
(ii) Natural passive immunity – It is passively transferred from mother to fetus through placenta, as IgG antibodies can cross placental barrier to reach the fetus.

20. Explain the work carried out by Cohen and Boyer that contributed immensely in biotechnology.
Answer : Cohen and Boyer contributed to the field of biotechnology by constructing the first recombinant DNA molecule in 1972. They cut the piece of DNA from a plasmid carrying antibiotic resistance gene, using restriction enzymes. This piece of foreign DNA, was linked with the plasmid DNA, acting as a vector with the help of enzyme DNA ligase. This newly formed DNA molecule is called recombinant DNA.

21. What are the differences between action of exonucleases and endonucleases?
Answer :  Differences between action of exonucleases and endonucleases are as follows : (Image 158)

22. Briefly explain Western blotting.
Answer : Western blotting is a process where proteins are electrophoresed in polyacrylamide gel, transferred onto a nitrocellulose or nylon membrane (to which they bind strongly) and the protein bands are detected by their specific interaction with antibodies, lectins or other protein compounds.

23. A template strand is given below. Write down the corresponding coding strand and the mRNA strand that can be formed, along with their polarity.
3′ ATGCATGCATGCATGCATGCATGC 5′
Answer : The corresponding coding strand is : 5′ TACGTACGTACGTACGTACGTACG 3′ The corresponding mRNA strand is 5′ UACGUACGUACGUACGUACGUACG 3′

24. Write the types of sex-determination mechanisms the following crosses show. Give an example of each type.
(i) Female XX with male XO
(ii) Female ZW with male ZZ.
Answer : (i) The type of sex determination mechanism shown in female XX with male XO is called male heterogamety. In this case male are heterogametic with half the male gametes carrying X-chromosome while the other half being devoid of it, e.g., grasshopper.
(ii) The type of sex determination mechanism shown in female ZW with male ZZ is female heterogamety because female produces two different types of gametes, e.g., birds.

25. Name and explain the interaction, that is seen between clownfish and sea anemones.
Answer : Commensalism is the interaction between clownfish and sea anemone. The clownfish lives among the stinging tentacles of sea anemone and gets protection from its predators which stay away from the stinging tentacles. The sea anemone does not appear to derive any benefit by hosting the clownfish.

SECTION – C

26. Enumerate the events in the ovary of a human female during:
(i) Follicular phase,
(ii) Luteal phase of menstrual cycle.
Answer : (i) During follicular phase, ovarian follicle secretes estrogens under the influence of FSH secreted by anterior pituitary. Estrogens stimulate the proliferation of the endometrium of the uterine wall.
(ii) During luteal phase, the remaining cells of the ovarian follicles after ovulation are stimulated by LH to develop corpus luteum. The corpus luteum secretes progesterone that stimulates the uterine glands to produce increased amount of mucus and is also essential for the maintenance of the endometrium which is necessary for implantation of the fertilised ovum.

27. (a) How codon is different from anticodon?
(b) Explain Chargaff’s rules.
Answer : (a) Differences between Codon and Anticodon. (IMage 159) (b) Chargaff (1950) made generalisations on the bases and other content of DNA.
These generalisations are :
(i) Purines and pyrimidine base pairs are in equal amounts, i.e., adenine + guanine = thymine + cytosine.
(ii) The ratio of [A+T/G+C] is variable, but constant for a species. It can be used to identify the source of DNA. This ratio is low in primitive organisms, and higher in advanced ones. (iii) Sugar deoxyribose and phosphate occur in equimolar proportions.
(iv) Molar amount of adenine is always equal to molar amount of thymine. Similarly, molar concentration of guanine equals molar concentration of cytosine.

28. What is the functional difference between B-cells and T-cells?
Answer : Differences between the role of B-lymphocytes (B-cells) and T-lymphocytes (T-cells) in generating immune responses are : (IMage 159)

29. Describe any six advantages of genetically modified plants.
Answer :  Applications of genetically modified plants are as follows:
(i) These plants are resistant to
(a) diseases resulting from viral, bacterial and fungal infections
(b) pests, such as nematodes and insects and
(c) pesticides.
(ii) They can tolerate adverse abiotic stresses such as cold, drought, salt, heat, etc.
(iii) They show increased efficiency of mineral usage (this prevents early exhaustion of fertility of soil).
(iv) GM plants have high nutritional value, e.g., vitamin A enriched rice. 
(v) Plants such as poplar (Populus) trees have been genetically engineered to clean up heavy pollution from contaminated soil.
(vi) These plants helped to reduce post harvest losses, e.g., Flavr Savr transgenic tomato.

30. Refer to the given graph and answer the following questions. (Image 154)(i)
What does the graph represent? Identify A, B and C.
(ii) Differentiate between A and B.
(iii) How organism C regulates their body functions?
Answer : (i) The given graph represents various ways of organismic response i.e., possibilities of living organisms to cope with stressful conditions. A represents the conformers, B represents regulators and C represents partial regulators. (ii) Differences between A (conformers) and B (regulators) are as follows: (IMage 160) (iii) C i.e., partials regulators have the ability to regulate body functions to a limited extent. Beyond that limit they become conformers.

OR

Study the given figures and answer the followings: (Image 155)
(i) Identify the given figures X, Y and Z. What does X represent?
(ii) Write a short note on Y.
(iii) Briefly describe the growth status of Z.
Answer : (i) The given figures represent different age pyramids of human population. X represents expanding population,Y represents stable population and Z represents declining population. (ii) Age pyramid Y showing stable population is bell-shaped. In this pyramid, the number of prereproductive and reproductive individuals is almost equal. Number of post-reproductive individuals is few. The population size remains stable, neither growing nor declining.
(iii) Z is an urn-shaped age pyramid. In this pyramid proportion of reproductive age group is higher than the individuals in pre-reproductive age group. It is declining or diminishing population with negative growth.

SECTION – D

31. Observe the given figures and answer the following questions. (Image 155)
(i) Identify the given figures A, B and C.
(ii) Explain the role of figure B and C.
(iii) Define the figure A.
Answer : (i) Here, A is hormone implant capsules, B is CuT and C is Multiload 375.
(ii) CuT and Multiload 375 are types of copper releasing intra-uterine devices (IUDs). These devices increase phagocytosis of sperms within the uterus and the Cu ions released suppress sperm motility and the fertilising capacity of sperms.
(iii) Hormone implant capsules or norplant is a type of subcutaneous implantation of synthetic progesterone. It acts by blocking ovulation and thickening the cervical mucus to prevent sperm transport. Six matchsticksized capsules containing the steroid are inserted under the skin of the inner arm above the elbow. The capsules slowly release the synthetic progesterone for about five years. It is very safe, convenient, and effective and longlasting (5 years). The woman has irregular periods or periods may be absent. Minor surgical procedure is needed for insertion and removal.

OR

Consider the given figure and answer the following questions.  (Image 155)
(i) Identify A, B, C, D and E in the given figure.
(ii) Briefly describe the procedure given in the figure.
(iii) How this procedure is being misused?
Answer : (i) In the given figure, A is placenta, B is uterine wall, C is amniotic fluid, D are the cells shed by growing fetus and E is syringe with needle that withdraws a small amount of fluid and cells. (ii) The given figure represents the procedure of amniocentesis in which amniotic fluid containing cells from the skin of the fetus and other sources are withdrawn by using a special surgical syringe with needle. These cells are cultured and are used to determine chromosomal abnormalities such as Down’s syndrome, Klinefelter’s syndrome and metabolic disorders such as phenylketonuria; sickle cell anaemia of the fetus.
(iii) Unfortunately, amniocentesis is being misused to kill the normal female fetus. Therefore, it is legally banned for the determination of sex to avoid female feticide.

32. (a) Differentiate between repetitive and satellite DNA.
(b) How can satellite DNA be isolated? Explain.
(c) List two forensic applications of DNA fingerprinting.
Answer : (a) Difference between repetitive and satellite DNA are as follows : (Image 160)
(b) Satellite DNA can be isolated from bulk genomic DNA by density gradient centrifugation. (c) DNA fingerprinting is very useful in detection of crime and legal pursuit.

OR

Explain the process of translation.
Answer : The process of decoding of the message from mRNA to protein with the help of tRNA, ribosome and enzyme is called translation (protein synthesis). Protein synthesis occurs over ribosomes. The 4 main steps in protein synthesis (translation) are : activation, initiation, elongation and termination of polypeptide chain. The newly synthesised mRNA joins the smaller subunit of ribosome at 5′ end. mRNAs carry the codon and tRNAs carry the anticodon for the same codon. Activation of amino acid is catalysed by the enzyme aminoacyl tRNA synthetase in the presence of ATP. In presence of ATP an amino acid combines with its specific amino acyl-tRNA synthetase to produce aminoacyl adenylate enzyme complex. This reacts with tRNA to form aminoacyl-tRNA complex. Activated tRNA is taken to ribosome mRNA complex for initiation of protein synthesis. Initiation of protein synthesis is accomplished with the help of initiation factor which are 3 (IF3, IF2, IF1) in prokaryotes and 9 in eukaryotes (eIF2, eIF3, eIF1, eIF4A, eIF4B, eIF4C, eIF4D, eIF5, eIF6). The ribosome binds to the mRNA at the start codon (AUG) that is recognised only by the initiator tRNA. A polypeptide chain forms as tRNAs deliver amino acids to the ribosome. Large ribosomal subunit binds the initiation complex forming two (A and P) binding site for tRNA molecules. The first site is P site or peptidyl site which is occupied by tRNAmet. The second site is A or amino acyl site and is positioned over the second codon. The ribosome proceeds to the elongation phase of protein synthesis. During this stage, complexes composed of an amino acid linked to tRNA, sequentially bind to the appropriate codon in mRNA by forming complementary base pairs with the tRNA anticodon. The ribosome moves from codon to codon along the mRNA. Amino acids are added one by one, translated into polypeptide sequences dictated by DNA and represented by mRNA. The enzyme peptidyl synthetase catalyses the formation of peptide bond between the carboxylic group of amino acid at P site and amino group of amino acid at A site. Enzyme translocase brings about the movement of mRNA by one codon. The termination of protein synthesis occur when a non-sense codon reaches at A site of ribosome. The chain detaches from the ribosome. A release factor binds to the stop codon, terminating translation and releasing the complete polypeptide from the ribosome. Two subunits of ribosomes dissociate with the help of dissociation factor.

33. (a) Name the category of microbes occurring naturally in sewage and making it less polluted during the treatment.
(b) Explain the different steps involved in the secondary treatment of sewage.
Answer : (a) Aerobic heterotrophs like bacteria and fungi occur in sewage water. They are natural decomposers and digest a lot of organic matter present in the polluted water thereby releasing minerals and reducing organic waste. Hence, they play an important role in cleaning water and making it fit for various domestic uses.
(b) Secondary treatment of the sewage is also called biological treatment because microbes are used to digest the organic matter in the sewage water.
The steps involved in the process are :
(i) Primary effluent is passed into aeration tank where liquid is constantly agitated and air is pumped into it.
(ii) Large number of aerobic heterotrophic microbes grow in aeration tank and form flocs.
(iii) Microbes digest organic matter, convert it into microbial biomass and reduce BOD.
(iv) In settling tank, the bacterial flocs are allowed to undergo sedimentation. The effluent is passed into natural waters like rivers and streams. It can also be further treated with chemicals to purify it.
(v) The sediment is called activated sludge. A part of this sludge is passed into anaerobic sludge digester where anaerobic microbes digest the organic mass as well as aerobic microbes.
(vi) During digestion, microbes produce methane, H2S and CO2. These gases form biogas that can be used as source of energy.

OR

Study the picture of biogas plant given below and answer the questions that follow.(Image 156)
(i) Name the components gaining entry from A into the chamber.
(ii) Mention the group of bacteria and the condition in which they act on the component that entered from A in the digester.
(iii) Name the components that get collected in gas holder.
Answer : (i) Dung and water enter the digester chamber from A.
(ii) The group of bacteria found in biogas plant are methanogens. Methanogens are a group of anaerobic bacteria which obtain their energy by reducing carbon dioxide and oxidising hydrogen with the production of methane. These microorganisms are present in anaerobic sludge digester where they digest organic mass as well as aerobic microbes of the sludge. (iii) Biogas is a methane rich fuel gas produced by anaerobic breakdown of biomass with the help of methanogenic bacteria. It is made up of methane (50-70%), carbon dioxide(30-40%) with traces of nitrogen, hydrogen sulphide and hydrogen.